diff --git a/nucleotide-count/.exercism/config.json b/nucleotide-count/.exercism/config.json new file mode 100644 index 0000000..264b918 --- /dev/null +++ b/nucleotide-count/.exercism/config.json @@ -0,0 +1,31 @@ +{ + "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.", + "authors": [ + "LegalizeAdulthood" + ], + "contributors": [ + "cyborgsphinx", + "elyashiv", + "jackhughesweb", + "KevinWMatthews", + "kytrinyx", + "objarni", + "patricksjackson", + "sjakobi" + ], + "files": { + "solution": [ + "nucleotide_count.cpp", + "nucleotide_count.h" + ], + "test": [ + "nucleotide_count_test.cpp" + ], + "example": [ + ".meta/example.cpp", + ".meta/example.h" + ] + }, + "source": "The Calculating DNA Nucleotides_problem at Rosalind", + "source_url": "http://rosalind.info/problems/dna/" +} diff --git a/nucleotide-count/.exercism/metadata.json b/nucleotide-count/.exercism/metadata.json new file mode 100644 index 0000000..36faacf --- /dev/null +++ b/nucleotide-count/.exercism/metadata.json @@ -0,0 +1 @@ +{"track":"cpp","exercise":"nucleotide-count","id":"07a7538c6fa74e25ab4f50d4d5d64f8c","url":"https://exercism.org/tracks/cpp/exercises/nucleotide-count","handle":"wooksong","is_requester":true,"auto_approve":false} \ No newline at end of file diff --git a/nucleotide-count/CMakeLists.txt b/nucleotide-count/CMakeLists.txt new file mode 100644 index 0000000..3b0589f --- /dev/null +++ b/nucleotide-count/CMakeLists.txt @@ -0,0 +1,64 @@ +# Get the exercise name from the current directory +get_filename_component(exercise ${CMAKE_CURRENT_SOURCE_DIR} NAME) + +# Basic CMake project +cmake_minimum_required(VERSION 3.5.1) + +# Name the project after the exercise +project(${exercise} CXX) + +# Get a source filename from the exercise name by replacing -'s with _'s +string(REPLACE "-" "_" file ${exercise}) + +# Implementation could be only a header +if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/${file}.cpp) + set(exercise_cpp ${file}.cpp) +else() + set(exercise_cpp "") +endif() + +# Use the common Catch library? +if(EXERCISM_COMMON_CATCH) + # For Exercism track development only + add_executable(${exercise} ${file}_test.cpp ${exercise_cpp} ${file}.h $) +elseif(EXERCISM_TEST_SUITE) + # The Exercism test suite is being run, the Docker image already + # includes a pre-built version of Catch. + find_package(Catch2 REQUIRED) + add_executable(${exercise} ${file}_test.cpp ${exercise_cpp} ${file}.h) + target_link_libraries(${exercise} PRIVATE Catch2::Catch2WithMain) + # When Catch is installed system wide we need to include a different + # header, we need this define to use the correct one. + target_compile_definitions(${exercise} PRIVATE EXERCISM_TEST_SUITE) +else() + # Build executable from sources and headers + add_executable(${exercise} ${file}_test.cpp ${exercise_cpp} ${file}.h test/tests-main.cpp) +endif() + +set_target_properties(${exercise} PROPERTIES + CXX_STANDARD 17 + CXX_STANDARD_REQUIRED OFF + CXX_EXTENSIONS OFF +) + +set(CMAKE_BUILD_TYPE Debug) + +if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)") + set_target_properties(${exercise} PROPERTIES + COMPILE_FLAGS "-Wall -Wextra -Wpedantic -Werror" + ) +endif() + +# Configure to run all the tests? +if(${EXERCISM_RUN_ALL_TESTS}) + target_compile_definitions(${exercise} PRIVATE EXERCISM_RUN_ALL_TESTS) +endif() + +# Tell MSVC not to warn us about unchecked iterators in debug builds +if(${MSVC}) + set_target_properties(${exercise} PROPERTIES + COMPILE_DEFINITIONS_DEBUG _SCL_SECURE_NO_WARNINGS) +endif() + +# Run the tests on every build +add_custom_target(test_${exercise} ALL DEPENDS ${exercise} COMMAND ${exercise}) diff --git a/nucleotide-count/HELP.md b/nucleotide-count/HELP.md new file mode 100644 index 0000000..d414c73 --- /dev/null +++ b/nucleotide-count/HELP.md @@ -0,0 +1,55 @@ +# Help + +## Running the tests + +Running the tests involves running `cmake -G` and then using the build command appropriate for your platform. +Detailed instructions on how to do this can be found on the [Running the Tests](https://exercism.io/tracks/cpp/tests) page for C++ on exercism.io. + +## Passing the Tests + +Get the first test compiling, linking and passing by following the [three +rules of test-driven development](http://butunclebob.com/ArticleS.UncleBob.TheThreeRulesOfTdd). +Create just enough structure by declaring namespaces, functions, classes, +etc., to satisfy any compiler errors and get the test to fail. Then write +just enough code to get the test to pass. Once you've done that, +uncomment the next test by moving the following line past the next test. + +```C++ +#if defined(EXERCISM_RUN_ALL_TESTS) +``` + +This may result in compile errors as new constructs may be invoked that +you haven't yet declared or defined. Again, fix the compile errors minimally +to get a failing test, then change the code minimally to pass the test, +refactor your implementation for readability and expressiveness and then +go on to the next test. + +Try to use standard C++11 facilities in preference to writing your own +low-level algorithms or facilities by hand. + +## Submitting your solution + +You can submit your solution using the `exercism submit nucleotide_count.cpp nucleotide_count.h` command. +This command will upload your solution to the Exercism website and print the solution page's URL. + +It's possible to submit an incomplete solution which allows you to: + +- See how others have completed the exercise +- Request help from a mentor + +## Need to get help? + +If you'd like help solving the exercise, check the following pages: + +- The [C++ track's documentation](https://exercism.org/docs/tracks/cpp) +- [Exercism's support channel on gitter](https://gitter.im/exercism/support) +- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs) + +Should those resources not suffice, you could submit your (incomplete) solution to request mentoring. + +To get help if you're having trouble, you can use one of the following resources: + +- [`c++-faq` tag on StackOverflow](https://stackoverflow.com/tags/c%2b%2b-faq/info) +- [C++ FAQ from isocpp.com](https://isocpp.org/faq) +- [CppReference](http://en.cppreference.com/) is a wiki reference to the C++ language and standard library +- [C traps and pitfalls](http://www.slideshare.net/LegalizeAdulthood/c-traps-and-pitfalls-for-c-programmers) is useful if you are new to C++, but have programmed in C \ No newline at end of file diff --git a/nucleotide-count/README.md b/nucleotide-count/README.md new file mode 100644 index 0000000..47ffbb8 --- /dev/null +++ b/nucleotide-count/README.md @@ -0,0 +1,47 @@ +# Nucleotide Count + +Welcome to Nucleotide Count on Exercism's C++ Track. +If you need help running the tests or submitting your code, check out `HELP.md`. + +## Instructions + +Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed. All known life depends on DNA! + +> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise. + +DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine. A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important! +We call the order of these nucleotides in a bit of DNA a "DNA sequence". + +We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides. +'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine. + +Given a string representing a DNA sequence, count how many of each nucleotide is present. +If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error. + +For example: + +``` +"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2 +"INVALID" -> error +``` + +## Source + +### Created by + +- @LegalizeAdulthood + +### Contributed to by + +- @cyborgsphinx +- @elyashiv +- @jackhughesweb +- @KevinWMatthews +- @kytrinyx +- @objarni +- @patricksjackson +- @sjakobi + +### Based on + +The Calculating DNA Nucleotides_problem at Rosalind - http://rosalind.info/problems/dna/ \ No newline at end of file diff --git a/nucleotide-count/nucleotide_count.cpp b/nucleotide-count/nucleotide_count.cpp new file mode 100644 index 0000000..469e476 --- /dev/null +++ b/nucleotide-count/nucleotide_count.cpp @@ -0,0 +1,39 @@ +#include "nucleotide_count.h" + +#include +#include + +namespace nucleotide_count { + +constexpr char NUCLEOTIDES[] = {'A', 'C', 'G', 'T'}; +constexpr char ERRMSG_EINVAL[] = + " is not the character representing one of the nucleotides"; + +counter::counter(const std::string dna_sq) { + std::string nucleotides(NUCLEOTIDES); + + for (size_t n = 0; n < sizeof(NUCLEOTIDES); ++n) { + this->m_nucleotide_to_counts[NUCLEOTIDES[n]] = 0; + } + + for (auto n : dna_sq) { + if (nucleotides.find(n) == std::string::npos) { + throw std::invalid_argument(std::string(1, n).append(ERRMSG_EINVAL)); + } + + this->m_nucleotide_to_counts[n]++; + } +} + +std::map counter::nucleotide_counts() const { + return this->m_nucleotide_to_counts; +} + +int counter::count(char n) const { + if (std::string(NUCLEOTIDES).find(n) == std::string::npos) { + throw std::invalid_argument(std::string(1, n).append(ERRMSG_EINVAL)); + } + return this->m_nucleotide_to_counts.at(n); +} + +} // namespace nucleotide_count diff --git a/nucleotide-count/nucleotide_count.h b/nucleotide-count/nucleotide_count.h new file mode 100644 index 0000000..e0bbeff --- /dev/null +++ b/nucleotide-count/nucleotide_count.h @@ -0,0 +1,23 @@ +#if !defined(NUCLEOTIDE_COUNT_H) +#define NUCLEOTIDE_COUNT_H + +#include +#include + +namespace nucleotide_count { + +class counter { + public: + counter(const std::string dna_sq); + std::map nucleotide_counts() const; + int count(char n) const; + + private: + counter(); + + std::map m_nucleotide_to_counts; +}; + +} // namespace nucleotide_count + +#endif // NUCLEOTIDE_COUNT_H diff --git a/nucleotide-count/nucleotide_count_test.cpp b/nucleotide-count/nucleotide_count_test.cpp new file mode 100644 index 0000000..2ad4474 --- /dev/null +++ b/nucleotide-count/nucleotide_count_test.cpp @@ -0,0 +1,82 @@ +#include "nucleotide_count.h" +#ifdef EXERCISM_TEST_SUITE +#include +#else +#include "test/catch.hpp" +#endif +#include +#include + +TEST_CASE("has_no_nucleotides") +{ + const nucleotide_count::counter dna(""); + const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 0} }; + + const auto actual = dna.nucleotide_counts(); + + REQUIRE(expected == actual); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +TEST_CASE("has_no_adenosine") +{ + const nucleotide_count::counter dna(""); + + REQUIRE(0 == dna.count('A')); +} + +TEST_CASE("repetitive_cytidine_gets_counts") +{ + const nucleotide_count::counter dna("CCCCC"); + + REQUIRE(5 == dna.count('C')); +} + +TEST_CASE("repetitive_sequence_has_only_guanosine") +{ + const nucleotide_count::counter dna("GGGGGGGG"); + const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 8} }; + + const auto actual = dna.nucleotide_counts(); + + REQUIRE(expected == actual); +} + +TEST_CASE("counts_only_thymidine") +{ + const nucleotide_count::counter dna("GGGGTAACCCGG"); + + REQUIRE(1 == dna.count('T')); +} + +TEST_CASE("counts_a_nucleotide_only_once") +{ + const nucleotide_count::counter dna("GGTTGG"); + + dna.count('T'); + + REQUIRE(2 == dna.count('T')); +} + +TEST_CASE("validates_nucleotides") +{ + const nucleotide_count::counter dna("GGTTGG"); + + REQUIRE_THROWS_AS(dna.count('X'), std::invalid_argument); +} + +TEST_CASE("validates_nucleotides_on_construction") +{ + REQUIRE_THROWS_AS(nucleotide_count::counter("GGTTGGX"), std::invalid_argument); +} + +TEST_CASE("counts_all_nucleotides") +{ + const nucleotide_count::counter dna("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"); + std::map expected{ {'A', 20}, {'T', 21}, {'G', 17}, {'C', 12} }; + + auto actual = dna.nucleotide_counts(); + + REQUIRE(expected == actual); +} +#endif diff --git a/nucleotide-count/test/catch.hpp b/nucleotide-count/test/catch.hpp new file mode 100644 index 0000000..36eaeb2 --- /dev/null +++ b/nucleotide-count/test/catch.hpp @@ -0,0 +1,17937 @@ +/* + * Catch v2.13.6 + * Generated: 2021-04-16 18:23:38.044268 + * ---------------------------------------------------------- + * This file has been merged from multiple headers. Please don't edit it directly + * Copyright (c) 2021 Two Blue Cubes Ltd. All rights reserved. + * + * Distributed under the Boost Software License, Version 1.0. (See accompanying + * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) + */ +#ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +#define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +// start catch.hpp + + +#define CATCH_VERSION_MAJOR 2 +#define CATCH_VERSION_MINOR 13 +#define CATCH_VERSION_PATCH 6 + +#ifdef __clang__ +# pragma clang system_header +#elif defined __GNUC__ +# pragma GCC system_header +#endif + +// start catch_suppress_warnings.h + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(push) +# pragma warning(disable: 161 1682) +# else // __ICC +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wpadded" +# pragma clang diagnostic ignored "-Wswitch-enum" +# pragma clang diagnostic ignored "-Wcovered-switch-default" +# endif +#elif defined __GNUC__ + // Because REQUIREs trigger GCC's -Wparentheses, and because still + // supported version of g++ have only buggy support for _Pragmas, + // Wparentheses have to be suppressed globally. +# pragma GCC diagnostic ignored "-Wparentheses" // See #674 for details + +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wunused-variable" +# pragma GCC diagnostic ignored "-Wpadded" +#endif +// end catch_suppress_warnings.h +#if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) +# define CATCH_IMPL +# define CATCH_CONFIG_ALL_PARTS +#endif + +// In the impl file, we want to have access to all parts of the headers +// Can also be used to sanely support PCHs +#if defined(CATCH_CONFIG_ALL_PARTS) +# define CATCH_CONFIG_EXTERNAL_INTERFACES +# if defined(CATCH_CONFIG_DISABLE_MATCHERS) +# undef CATCH_CONFIG_DISABLE_MATCHERS +# endif +# if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# endif +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) +// start catch_platform.h + +// See e.g.: +// https://opensource.apple.com/source/CarbonHeaders/CarbonHeaders-18.1/TargetConditionals.h.auto.html +#ifdef __APPLE__ +# include +# if (defined(TARGET_OS_OSX) && TARGET_OS_OSX == 1) || \ + (defined(TARGET_OS_MAC) && TARGET_OS_MAC == 1) +# define CATCH_PLATFORM_MAC +# elif (defined(TARGET_OS_IPHONE) && TARGET_OS_IPHONE == 1) +# define CATCH_PLATFORM_IPHONE +# endif + +#elif defined(linux) || defined(__linux) || defined(__linux__) +# define CATCH_PLATFORM_LINUX + +#elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) || defined(__MINGW32__) +# define CATCH_PLATFORM_WINDOWS +#endif + +// end catch_platform.h + +#ifdef CATCH_IMPL +# ifndef CLARA_CONFIG_MAIN +# define CLARA_CONFIG_MAIN_NOT_DEFINED +# define CLARA_CONFIG_MAIN +# endif +#endif + +// start catch_user_interfaces.h + +namespace Catch { + unsigned int rngSeed(); +} + +// end catch_user_interfaces.h +// start catch_tag_alias_autoregistrar.h + +// start catch_common.h + +// start catch_compiler_capabilities.h + +// Detect a number of compiler features - by compiler +// The following features are defined: +// +// CATCH_CONFIG_COUNTER : is the __COUNTER__ macro supported? +// CATCH_CONFIG_WINDOWS_SEH : is Windows SEH supported? +// CATCH_CONFIG_POSIX_SIGNALS : are POSIX signals supported? +// CATCH_CONFIG_DISABLE_EXCEPTIONS : Are exceptions enabled? +// **************** +// Note to maintainers: if new toggles are added please document them +// in configuration.md, too +// **************** + +// In general each macro has a _NO_ form +// (e.g. CATCH_CONFIG_NO_POSIX_SIGNALS) which disables the feature. +// Many features, at point of detection, define an _INTERNAL_ macro, so they +// can be combined, en-mass, with the _NO_ forms later. + +#ifdef __cplusplus + +# if (__cplusplus >= 201402L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201402L) +# define CATCH_CPP14_OR_GREATER +# endif + +# if (__cplusplus >= 201703L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201703L) +# define CATCH_CPP17_OR_GREATER +# endif + +#endif + +// Only GCC compiler should be used in this block, so other compilers trying to +// mask themselves as GCC should be ignored. +#if defined(__GNUC__) && !defined(__clang__) && !defined(__ICC) && !defined(__CUDACC__) && !defined(__LCC__) +# define CATCH_INTERNAL_START_WARNINGS_SUPPRESSION _Pragma( "GCC diagnostic push" ) +# define CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION _Pragma( "GCC diagnostic pop" ) + +# define CATCH_INTERNAL_IGNORE_BUT_WARN(...) (void)__builtin_constant_p(__VA_ARGS__) + +#endif + +#if defined(__clang__) + +# define CATCH_INTERNAL_START_WARNINGS_SUPPRESSION _Pragma( "clang diagnostic push" ) +# define CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION _Pragma( "clang diagnostic pop" ) + +// As of this writing, IBM XL's implementation of __builtin_constant_p has a bug +// which results in calls to destructors being emitted for each temporary, +// without a matching initialization. In practice, this can result in something +// like `std::string::~string` being called on an uninitialized value. +// +// For example, this code will likely segfault under IBM XL: +// ``` +// REQUIRE(std::string("12") + "34" == "1234") +// ``` +// +// Therefore, `CATCH_INTERNAL_IGNORE_BUT_WARN` is not implemented. +# if !defined(__ibmxl__) && !defined(__CUDACC__) +# define CATCH_INTERNAL_IGNORE_BUT_WARN(...) (void)__builtin_constant_p(__VA_ARGS__) /* NOLINT(cppcoreguidelines-pro-type-vararg, hicpp-vararg) */ +# endif + +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic ignored \"-Wexit-time-destructors\"" ) \ + _Pragma( "clang diagnostic ignored \"-Wglobal-constructors\"") + +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic ignored \"-Wparentheses\"" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic ignored \"-Wunused-variable\"" ) + +# define CATCH_INTERNAL_SUPPRESS_ZERO_VARIADIC_WARNINGS \ + _Pragma( "clang diagnostic ignored \"-Wgnu-zero-variadic-macro-arguments\"" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_TEMPLATE_WARNINGS \ + _Pragma( "clang diagnostic ignored \"-Wunused-template\"" ) + +#endif // __clang__ + +//////////////////////////////////////////////////////////////////////////////// +// Assume that non-Windows platforms support posix signals by default +#if !defined(CATCH_PLATFORM_WINDOWS) + #define CATCH_INTERNAL_CONFIG_POSIX_SIGNALS +#endif + +//////////////////////////////////////////////////////////////////////////////// +// We know some environments not to support full POSIX signals +#if defined(__CYGWIN__) || defined(__QNX__) || defined(__EMSCRIPTEN__) || defined(__DJGPP__) + #define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +#endif + +#ifdef __OS400__ +# define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +# define CATCH_CONFIG_COLOUR_NONE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Android somehow still does not support std::to_string +#if defined(__ANDROID__) +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING +# define CATCH_INTERNAL_CONFIG_ANDROID_LOGWRITE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Not all Windows environments support SEH properly +#if defined(__MINGW32__) +# define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH +#endif + +//////////////////////////////////////////////////////////////////////////////// +// PS4 +#if defined(__ORBIS__) +# define CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Cygwin +#ifdef __CYGWIN__ + +// Required for some versions of Cygwin to declare gettimeofday +// see: http://stackoverflow.com/questions/36901803/gettimeofday-not-declared-in-this-scope-cygwin +# define _BSD_SOURCE +// some versions of cygwin (most) do not support std::to_string. Use the libstd check. +// https://gcc.gnu.org/onlinedocs/gcc-4.8.2/libstdc++/api/a01053_source.html line 2812-2813 +# if !((__cplusplus >= 201103L) && defined(_GLIBCXX_USE_C99) \ + && !defined(_GLIBCXX_HAVE_BROKEN_VSWPRINTF)) + +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING + +# endif +#endif // __CYGWIN__ + +//////////////////////////////////////////////////////////////////////////////// +// Visual C++ +#if defined(_MSC_VER) + +# define CATCH_INTERNAL_START_WARNINGS_SUPPRESSION __pragma( warning(push) ) +# define CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION __pragma( warning(pop) ) + +// Universal Windows platform does not support SEH +// Or console colours (or console at all...) +# if defined(WINAPI_FAMILY) && (WINAPI_FAMILY == WINAPI_FAMILY_APP) +# define CATCH_CONFIG_COLOUR_NONE +# else +# define CATCH_INTERNAL_CONFIG_WINDOWS_SEH +# endif + +// MSVC traditional preprocessor needs some workaround for __VA_ARGS__ +// _MSVC_TRADITIONAL == 0 means new conformant preprocessor +// _MSVC_TRADITIONAL == 1 means old traditional non-conformant preprocessor +# if !defined(__clang__) // Handle Clang masquerading for msvc +# if !defined(_MSVC_TRADITIONAL) || (defined(_MSVC_TRADITIONAL) && _MSVC_TRADITIONAL) +# define CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +# endif // MSVC_TRADITIONAL +# endif // __clang__ + +#endif // _MSC_VER + +#if defined(_REENTRANT) || defined(_MSC_VER) +// Enable async processing, as -pthread is specified or no additional linking is required +# define CATCH_INTERNAL_CONFIG_USE_ASYNC +#endif // _MSC_VER + +//////////////////////////////////////////////////////////////////////////////// +// Check if we are compiled with -fno-exceptions or equivalent +#if defined(__EXCEPTIONS) || defined(__cpp_exceptions) || defined(_CPPUNWIND) +# define CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED +#endif + +//////////////////////////////////////////////////////////////////////////////// +// DJGPP +#ifdef __DJGPP__ +# define CATCH_INTERNAL_CONFIG_NO_WCHAR +#endif // __DJGPP__ + +//////////////////////////////////////////////////////////////////////////////// +// Embarcadero C++Build +#if defined(__BORLANDC__) + #define CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// Use of __COUNTER__ is suppressed during code analysis in +// CLion/AppCode 2017.2.x and former, because __COUNTER__ is not properly +// handled by it. +// Otherwise all supported compilers support COUNTER macro, +// but user still might want to turn it off +#if ( !defined(__JETBRAINS_IDE__) || __JETBRAINS_IDE__ >= 20170300L ) + #define CATCH_INTERNAL_CONFIG_COUNTER +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// RTX is a special version of Windows that is real time. +// This means that it is detected as Windows, but does not provide +// the same set of capabilities as real Windows does. +#if defined(UNDER_RTSS) || defined(RTX64_BUILD) + #define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH + #define CATCH_INTERNAL_CONFIG_NO_ASYNC + #define CATCH_CONFIG_COLOUR_NONE +#endif + +#if !defined(_GLIBCXX_USE_C99_MATH_TR1) +#define CATCH_INTERNAL_CONFIG_GLOBAL_NEXTAFTER +#endif + +// Various stdlib support checks that require __has_include +#if defined(__has_include) + // Check if string_view is available and usable + #if __has_include() && defined(CATCH_CPP17_OR_GREATER) + # define CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW + #endif + + // Check if optional is available and usable + # if __has_include() && defined(CATCH_CPP17_OR_GREATER) + # define CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL + # endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) + + // Check if byte is available and usable + # if __has_include() && defined(CATCH_CPP17_OR_GREATER) + # include + # if __cpp_lib_byte > 0 + # define CATCH_INTERNAL_CONFIG_CPP17_BYTE + # endif + # endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) + + // Check if variant is available and usable + # if __has_include() && defined(CATCH_CPP17_OR_GREATER) + # if defined(__clang__) && (__clang_major__ < 8) + // work around clang bug with libstdc++ https://bugs.llvm.org/show_bug.cgi?id=31852 + // fix should be in clang 8, workaround in libstdc++ 8.2 + # include + # if defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) + # define CATCH_CONFIG_NO_CPP17_VARIANT + # else + # define CATCH_INTERNAL_CONFIG_CPP17_VARIANT + # endif // defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) + # else + # define CATCH_INTERNAL_CONFIG_CPP17_VARIANT + # endif // defined(__clang__) && (__clang_major__ < 8) + # endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // defined(__has_include) + +#if defined(CATCH_INTERNAL_CONFIG_COUNTER) && !defined(CATCH_CONFIG_NO_COUNTER) && !defined(CATCH_CONFIG_COUNTER) +# define CATCH_CONFIG_COUNTER +#endif +#if defined(CATCH_INTERNAL_CONFIG_WINDOWS_SEH) && !defined(CATCH_CONFIG_NO_WINDOWS_SEH) && !defined(CATCH_CONFIG_WINDOWS_SEH) && !defined(CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH) +# define CATCH_CONFIG_WINDOWS_SEH +#endif +// This is set by default, because we assume that unix compilers are posix-signal-compatible by default. +#if defined(CATCH_INTERNAL_CONFIG_POSIX_SIGNALS) && !defined(CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_POSIX_SIGNALS) +# define CATCH_CONFIG_POSIX_SIGNALS +#endif +// This is set by default, because we assume that compilers with no wchar_t support are just rare exceptions. +#if !defined(CATCH_INTERNAL_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_WCHAR) +# define CATCH_CONFIG_WCHAR +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_CPP11_TO_STRING) +# define CATCH_CONFIG_CPP11_TO_STRING +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_NO_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_CPP17_OPTIONAL) +# define CATCH_CONFIG_CPP17_OPTIONAL +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_NO_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_CPP17_STRING_VIEW) +# define CATCH_CONFIG_CPP17_STRING_VIEW +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_VARIANT) && !defined(CATCH_CONFIG_NO_CPP17_VARIANT) && !defined(CATCH_CONFIG_CPP17_VARIANT) +# define CATCH_CONFIG_CPP17_VARIANT +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_BYTE) && !defined(CATCH_CONFIG_NO_CPP17_BYTE) && !defined(CATCH_CONFIG_CPP17_BYTE) +# define CATCH_CONFIG_CPP17_BYTE +#endif + +#if defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) +# define CATCH_INTERNAL_CONFIG_NEW_CAPTURE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_NEW_CAPTURE) && !defined(CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NEW_CAPTURE) +# define CATCH_CONFIG_NEW_CAPTURE +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +# define CATCH_CONFIG_DISABLE_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_NO_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_POLYFILL_ISNAN) +# define CATCH_CONFIG_POLYFILL_ISNAN +#endif + +#if defined(CATCH_INTERNAL_CONFIG_USE_ASYNC) && !defined(CATCH_INTERNAL_CONFIG_NO_ASYNC) && !defined(CATCH_CONFIG_NO_USE_ASYNC) && !defined(CATCH_CONFIG_USE_ASYNC) +# define CATCH_CONFIG_USE_ASYNC +#endif + +#if defined(CATCH_INTERNAL_CONFIG_ANDROID_LOGWRITE) && !defined(CATCH_CONFIG_NO_ANDROID_LOGWRITE) && !defined(CATCH_CONFIG_ANDROID_LOGWRITE) +# define CATCH_CONFIG_ANDROID_LOGWRITE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_GLOBAL_NEXTAFTER) && !defined(CATCH_CONFIG_NO_GLOBAL_NEXTAFTER) && !defined(CATCH_CONFIG_GLOBAL_NEXTAFTER) +# define CATCH_CONFIG_GLOBAL_NEXTAFTER +#endif + +// Even if we do not think the compiler has that warning, we still have +// to provide a macro that can be used by the code. +#if !defined(CATCH_INTERNAL_START_WARNINGS_SUPPRESSION) +# define CATCH_INTERNAL_START_WARNINGS_SUPPRESSION +#endif +#if !defined(CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION) +# define CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_ZERO_VARIADIC_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_ZERO_VARIADIC_WARNINGS +#endif + +// The goal of this macro is to avoid evaluation of the arguments, but +// still have the compiler warn on problems inside... +#if !defined(CATCH_INTERNAL_IGNORE_BUT_WARN) +# define CATCH_INTERNAL_IGNORE_BUT_WARN(...) +#endif + +#if defined(__APPLE__) && defined(__apple_build_version__) && (__clang_major__ < 10) +# undef CATCH_INTERNAL_SUPPRESS_UNUSED_TEMPLATE_WARNINGS +#elif defined(__clang__) && (__clang_major__ < 5) +# undef CATCH_INTERNAL_SUPPRESS_UNUSED_TEMPLATE_WARNINGS +#endif + +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_TEMPLATE_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_TEMPLATE_WARNINGS +#endif + +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +#define CATCH_TRY if ((true)) +#define CATCH_CATCH_ALL if ((false)) +#define CATCH_CATCH_ANON(type) if ((false)) +#else +#define CATCH_TRY try +#define CATCH_CATCH_ALL catch (...) +#define CATCH_CATCH_ANON(type) catch (type) +#endif + +#if defined(CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_NO_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) +#define CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#endif + +// end catch_compiler_capabilities.h +#define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line +#define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) +#ifdef CATCH_CONFIG_COUNTER +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __COUNTER__ ) +#else +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) +#endif + +#include +#include +#include + +// We need a dummy global operator<< so we can bring it into Catch namespace later +struct Catch_global_namespace_dummy {}; +std::ostream& operator<<(std::ostream&, Catch_global_namespace_dummy); + +namespace Catch { + + struct CaseSensitive { enum Choice { + Yes, + No + }; }; + + class NonCopyable { + NonCopyable( NonCopyable const& ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable& operator = ( NonCopyable const& ) = delete; + NonCopyable& operator = ( NonCopyable && ) = delete; + + protected: + NonCopyable(); + virtual ~NonCopyable(); + }; + + struct SourceLineInfo { + + SourceLineInfo() = delete; + SourceLineInfo( char const* _file, std::size_t _line ) noexcept + : file( _file ), + line( _line ) + {} + + SourceLineInfo( SourceLineInfo const& other ) = default; + SourceLineInfo& operator = ( SourceLineInfo const& ) = default; + SourceLineInfo( SourceLineInfo&& ) noexcept = default; + SourceLineInfo& operator = ( SourceLineInfo&& ) noexcept = default; + + bool empty() const noexcept { return file[0] == '\0'; } + bool operator == ( SourceLineInfo const& other ) const noexcept; + bool operator < ( SourceLineInfo const& other ) const noexcept; + + char const* file; + std::size_t line; + }; + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); + + // Bring in operator<< from global namespace into Catch namespace + // This is necessary because the overload of operator<< above makes + // lookup stop at namespace Catch + using ::operator<<; + + // Use this in variadic streaming macros to allow + // >> +StreamEndStop + // as well as + // >> stuff +StreamEndStop + struct StreamEndStop { + std::string operator+() const; + }; + template + T const& operator + ( T const& value, StreamEndStop ) { + return value; + } +} + +#define CATCH_INTERNAL_LINEINFO \ + ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) + +// end catch_common.h +namespace Catch { + + struct RegistrarForTagAliases { + RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); + }; + +} // end namespace Catch + +#define CATCH_REGISTER_TAG_ALIAS( alias, spec ) \ + CATCH_INTERNAL_START_WARNINGS_SUPPRESSION \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } \ + CATCH_INTERNAL_STOP_WARNINGS_SUPPRESSION + +// end catch_tag_alias_autoregistrar.h +// start catch_test_registry.h + +// start catch_interfaces_testcase.h + +#include + +namespace Catch { + + class TestSpec; + + struct ITestInvoker { + virtual void invoke () const = 0; + virtual ~ITestInvoker(); + }; + + class TestCase; + struct IConfig; + + struct ITestCaseRegistry { + virtual ~ITestCaseRegistry(); + virtual std::vector const& getAllTests() const = 0; + virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; + }; + + bool isThrowSafe( TestCase const& testCase, IConfig const& config ); + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + +} + +// end catch_interfaces_testcase.h +// start catch_stringref.h + +#include +#include +#include +#include + +namespace Catch { + + /// A non-owning string class (similar to the forthcoming std::string_view) + /// Note that, because a StringRef may be a substring of another string, + /// it may not be null terminated. + class StringRef { + public: + using size_type = std::size_t; + using const_iterator = const char*; + + private: + static constexpr char const* const s_empty = ""; + + char const* m_start = s_empty; + size_type m_size = 0; + + public: // construction + constexpr StringRef() noexcept = default; + + StringRef( char const* rawChars ) noexcept; + + constexpr StringRef( char const* rawChars, size_type size ) noexcept + : m_start( rawChars ), + m_size( size ) + {} + + StringRef( std::string const& stdString ) noexcept + : m_start( stdString.c_str() ), + m_size( stdString.size() ) + {} + + explicit operator std::string() const { + return std::string(m_start, m_size); + } + + public: // operators + auto operator == ( StringRef const& other ) const noexcept -> bool; + auto operator != (StringRef const& other) const noexcept -> bool { + return !(*this == other); + } + + auto operator[] ( size_type index ) const noexcept -> char { + assert(index < m_size); + return m_start[index]; + } + + public: // named queries + constexpr auto empty() const noexcept -> bool { + return m_size == 0; + } + constexpr auto size() const noexcept -> size_type { + return m_size; + } + + // Returns the current start pointer. If the StringRef is not + // null-terminated, throws std::domain_exception + auto c_str() const -> char const*; + + public: // substrings and searches + // Returns a substring of [start, start + length). + // If start + length > size(), then the substring is [start, size()). + // If start > size(), then the substring is empty. + auto substr( size_type start, size_type length ) const noexcept -> StringRef; + + // Returns the current start pointer. May not be null-terminated. + auto data() const noexcept -> char const*; + + constexpr auto isNullTerminated() const noexcept -> bool { + return m_start[m_size] == '\0'; + } + + public: // iterators + constexpr const_iterator begin() const { return m_start; } + constexpr const_iterator end() const { return m_start + m_size; } + }; + + auto operator += ( std::string& lhs, StringRef const& sr ) -> std::string&; + auto operator << ( std::ostream& os, StringRef const& sr ) -> std::ostream&; + + constexpr auto operator "" _sr( char const* rawChars, std::size_t size ) noexcept -> StringRef { + return StringRef( rawChars, size ); + } +} // namespace Catch + +constexpr auto operator "" _catch_sr( char const* rawChars, std::size_t size ) noexcept -> Catch::StringRef { + return Catch::StringRef( rawChars, size ); +} + +// end catch_stringref.h +// start catch_preprocessor.hpp + + +#define CATCH_RECURSION_LEVEL0(...) __VA_ARGS__ +#define CATCH_RECURSION_LEVEL1(...) CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL2(...) CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL3(...) CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL4(...) CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL5(...) CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(__VA_ARGS__))) + +#ifdef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_EXPAND_VARGS(...) __VA_ARGS__ +// MSVC needs more evaluations +#define CATCH_RECURSION_LEVEL6(...) CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(__VA_ARGS__))) +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL6(CATCH_RECURSION_LEVEL6(__VA_ARGS__)) +#else +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL5(__VA_ARGS__) +#endif + +#define CATCH_REC_END(...) +#define CATCH_REC_OUT + +#define CATCH_EMPTY() +#define CATCH_DEFER(id) id CATCH_EMPTY() + +#define CATCH_REC_GET_END2() 0, CATCH_REC_END +#define CATCH_REC_GET_END1(...) CATCH_REC_GET_END2 +#define CATCH_REC_GET_END(...) CATCH_REC_GET_END1 +#define CATCH_REC_NEXT0(test, next, ...) next CATCH_REC_OUT +#define CATCH_REC_NEXT1(test, next) CATCH_DEFER ( CATCH_REC_NEXT0 ) ( test, next, 0) +#define CATCH_REC_NEXT(test, next) CATCH_REC_NEXT1(CATCH_REC_GET_END test, next) + +#define CATCH_REC_LIST0(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2(f, x, peek, ...) f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) + +#define CATCH_REC_LIST0_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2_UD(f, userdata, x, peek, ...) f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) + +// Applies the function macro `f` to each of the remaining parameters, inserts commas between the results, +// and passes userdata as the first parameter to each invocation, +// e.g. CATCH_REC_LIST_UD(f, x, a, b, c) evaluates to f(x, a), f(x, b), f(x, c) +#define CATCH_REC_LIST_UD(f, userdata, ...) CATCH_RECURSE(CATCH_REC_LIST2_UD(f, userdata, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define CATCH_REC_LIST(f, ...) CATCH_RECURSE(CATCH_REC_LIST2(f, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define INTERNAL_CATCH_EXPAND1(param) INTERNAL_CATCH_EXPAND2(param) +#define INTERNAL_CATCH_EXPAND2(...) INTERNAL_CATCH_NO## __VA_ARGS__ +#define INTERNAL_CATCH_DEF(...) INTERNAL_CATCH_DEF __VA_ARGS__ +#define INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE(...) INTERNAL_CATCH_STRINGIZE2(__VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_STRINGIZE2(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) +#else +// MSVC is adding extra space and needs another indirection to expand INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE2(...) INTERNAL_CATCH_STRINGIZE3(__VA_ARGS__) +#define INTERNAL_CATCH_STRINGIZE3(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) (INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) + 1) +#endif + +#define INTERNAL_CATCH_MAKE_NAMESPACE2(...) ns_##__VA_ARGS__ +#define INTERNAL_CATCH_MAKE_NAMESPACE(name) INTERNAL_CATCH_MAKE_NAMESPACE2(name) + +#define INTERNAL_CATCH_REMOVE_PARENS(...) INTERNAL_CATCH_EXPAND1(INTERNAL_CATCH_DEF __VA_ARGS__) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_MAKE_TYPE_LIST2(...) decltype(get_wrapper()) +#define INTERNAL_CATCH_MAKE_TYPE_LIST(...) INTERNAL_CATCH_MAKE_TYPE_LIST2(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__)) +#else +#define INTERNAL_CATCH_MAKE_TYPE_LIST2(...) INTERNAL_CATCH_EXPAND_VARGS(decltype(get_wrapper())) +#define INTERNAL_CATCH_MAKE_TYPE_LIST(...) INTERNAL_CATCH_EXPAND_VARGS(INTERNAL_CATCH_MAKE_TYPE_LIST2(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__))) +#endif + +#define INTERNAL_CATCH_MAKE_TYPE_LISTS_FROM_TYPES(...)\ + CATCH_REC_LIST(INTERNAL_CATCH_MAKE_TYPE_LIST,__VA_ARGS__) + +#define INTERNAL_CATCH_REMOVE_PARENS_1_ARG(_0) INTERNAL_CATCH_REMOVE_PARENS(_0) +#define INTERNAL_CATCH_REMOVE_PARENS_2_ARG(_0, _1) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_1_ARG(_1) +#define INTERNAL_CATCH_REMOVE_PARENS_3_ARG(_0, _1, _2) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_2_ARG(_1, _2) +#define INTERNAL_CATCH_REMOVE_PARENS_4_ARG(_0, _1, _2, _3) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_3_ARG(_1, _2, _3) +#define INTERNAL_CATCH_REMOVE_PARENS_5_ARG(_0, _1, _2, _3, _4) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_4_ARG(_1, _2, _3, _4) +#define INTERNAL_CATCH_REMOVE_PARENS_6_ARG(_0, _1, _2, _3, _4, _5) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_5_ARG(_1, _2, _3, _4, _5) +#define INTERNAL_CATCH_REMOVE_PARENS_7_ARG(_0, _1, _2, _3, _4, _5, _6) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_6_ARG(_1, _2, _3, _4, _5, _6) +#define INTERNAL_CATCH_REMOVE_PARENS_8_ARG(_0, _1, _2, _3, _4, _5, _6, _7) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_7_ARG(_1, _2, _3, _4, _5, _6, _7) +#define INTERNAL_CATCH_REMOVE_PARENS_9_ARG(_0, _1, _2, _3, _4, _5, _6, _7, _8) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_8_ARG(_1, _2, _3, _4, _5, _6, _7, _8) +#define INTERNAL_CATCH_REMOVE_PARENS_10_ARG(_0, _1, _2, _3, _4, _5, _6, _7, _8, _9) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_9_ARG(_1, _2, _3, _4, _5, _6, _7, _8, _9) +#define INTERNAL_CATCH_REMOVE_PARENS_11_ARG(_0, _1, _2, _3, _4, _5, _6, _7, _8, _9, _10) INTERNAL_CATCH_REMOVE_PARENS(_0), INTERNAL_CATCH_REMOVE_PARENS_10_ARG(_1, _2, _3, _4, _5, _6, _7, _8, _9, _10) + +#define INTERNAL_CATCH_VA_NARGS_IMPL(_0, _1, _2, _3, _4, _5, _6, _7, _8, _9, _10, N, ...) N + +#define INTERNAL_CATCH_TYPE_GEN\ + template struct TypeList {};\ + template\ + constexpr auto get_wrapper() noexcept -> TypeList { return {}; }\ + template class...> struct TemplateTypeList{};\ + template class...Cs>\ + constexpr auto get_wrapper() noexcept -> TemplateTypeList { return {}; }\ + template\ + struct append;\ + template\ + struct rewrap;\ + template class, typename...>\ + struct create;\ + template class, typename>\ + struct convert;\ + \ + template \ + struct append { using type = T; };\ + template< template class L1, typename...E1, template class L2, typename...E2, typename...Rest>\ + struct append, L2, Rest...> { using type = typename append, Rest...>::type; };\ + template< template class L1, typename...E1, typename...Rest>\ + struct append, TypeList, Rest...> { using type = L1; };\ + \ + template< template class Container, template class List, typename...elems>\ + struct rewrap, List> { using type = TypeList>; };\ + template< template class Container, template class List, class...Elems, typename...Elements>\ + struct rewrap, List, Elements...> { using type = typename append>, typename rewrap, Elements...>::type>::type; };\ + \ + template